xhoi restriction enzyme (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
xhoi restriction enzyme
Xhoi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8890 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xhoi+restriction+enzyme/XhoI/pmc13127484-22-0-4
Average 99 stars, based on 8890 article reviews
Xhoi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8890 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xhoi+restriction+enzyme/XhoI/pmc13127484-22-0-4
Average 99 stars, based on 8890 article reviews
xhoi restriction enzyme - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Digital PCR:Article Title: HIV superinfection reveals sequential reservoir reactivation and immune-driven rebound dynamics Article Snippet: .. Briefly, the droplet digital PCR (ddPCR)-based intact proviral DNA assay (IPDA) was performed on CD4+ T cells isolated by negative selection from PBMC as previously described ( , ) where Isolation:Article Title: HIV superinfection reveals sequential reservoir reactivation and immune-driven rebound dynamics Article Snippet: .. Briefly, the droplet digital PCR (ddPCR)-based intact proviral DNA assay (IPDA) was performed on CD4+ T cells isolated by negative selection from PBMC as previously described ( , ) where Selection:Article Title: HIV superinfection reveals sequential reservoir reactivation and immune-driven rebound dynamics Article Snippet: .. Briefly, the droplet digital PCR (ddPCR)-based intact proviral DNA assay (IPDA) was performed on CD4+ T cells isolated by negative selection from PBMC as previously described ( , ) where Plasmid Preparation:Article Title: The neuropathy-linked protein TECPR2 is a Rab5 effector that regulates cargo recycling from early endosomes Article Snippet: .. The plasmid was linearized by digestion with Article Title: The neuropathy-linked protein TECPR2 is a Rab5 effector that regulates cargo recycling from early endosomes. Article Snippet: .. The plasmid was linearized by digestion with Article Title: Quantitative cellular characterization of extracellular mitochondria uptake and delivery Article Snippet: PCR amplified Cox8a-Hibit sequence from pSNAPf-Cox8A plasmid (101129, Addgene, MA) with the following primers: (Forward): GCCGCTAGCTACCATGTCCGTCCTGA. (Reverse): GCCCAATTGTTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTCACACTAGTCATGCTAGCGGATCCTCCACCAGAATTCCCACCGCTCGATCCACCGGAGGATCCGGTGAATTCACCGGT was then inserted using the same enzymes. .. Cox8a-Lgbit construct was obtained by removing snap tag from pSNAPf-Cox8A plasmid (101129, Addgene, MA) using EcoRi and Article Title: Quantitative cellular characterization of extracellular mitochondria uptake and delivery. Article Snippet: PCR amplified Cox8aHibit sequence from pSNAPf-Cox8A plasmid (101129, Addgene, MA) with the following primers: (Forward): GCCGCTAGCTACCATGTCC GTCCTGA. (Reverse): GCCCAATTGTTAGCTAATCTTCTTGAACAGCCG CCAGCCGCTCACACTAGTCATGCTAGCGGATCCTCCACCAGAATTCC CACCGCTCGATCCACCGGAGGATCCGGTGAATTCACCGGT was then inserted using the same enzymes. .. Cox8a-Lgbit construct was obtained by removing snap tag from pSNAPf-Cox8A plasmid (101129, Addgene, MA) using EcoRi and In Vitro:Article Title: The neuropathy-linked protein TECPR2 is a Rab5 effector that regulates cargo recycling from early endosomes Article Snippet: .. The plasmid was linearized by digestion with Article Title: The neuropathy-linked protein TECPR2 is a Rab5 effector that regulates cargo recycling from early endosomes. Article Snippet: .. The plasmid was linearized by digestion with Construct:Article Title: Quantitative cellular characterization of extracellular mitochondria uptake and delivery Article Snippet: PCR amplified Cox8a-Hibit sequence from pSNAPf-Cox8A plasmid (101129, Addgene, MA) with the following primers: (Forward): GCCGCTAGCTACCATGTCCGTCCTGA. (Reverse): GCCCAATTGTTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTCACACTAGTCATGCTAGCGGATCCTCCACCAGAATTCCCACCGCTCGATCCACCGGAGGATCCGGTGAATTCACCGGT was then inserted using the same enzymes. .. Cox8a-Lgbit construct was obtained by removing snap tag from pSNAPf-Cox8A plasmid (101129, Addgene, MA) using EcoRi and Article Title: Quantitative cellular characterization of extracellular mitochondria uptake and delivery. Article Snippet: PCR amplified Cox8aHibit sequence from pSNAPf-Cox8A plasmid (101129, Addgene, MA) with the following primers: (Forward): GCCGCTAGCTACCATGTCC GTCCTGA. (Reverse): GCCCAATTGTTAGCTAATCTTCTTGAACAGCCG CCAGCCGCTCACACTAGTCATGCTAGCGGATCCTCCACCAGAATTCC CACCGCTCGATCCACCGGAGGATCCGGTGAATTCACCGGT was then inserted using the same enzymes. .. Cox8a-Lgbit construct was obtained by removing snap tag from pSNAPf-Cox8A plasmid (101129, Addgene, MA) using EcoRi and Purification:Article Title: Large and low-PEG lipid nanoparticles enable efficient dendritic cell targeting for potent mRNA Cancer vaccines. Article Snippet: Efficient delivery of messenger RNA (mRNA) to dendritic cells (DCs) remains a major challenge limiting the efficacy of mRNA cancer vaccines.. Here, we report a large-sized lipid nanoparticle (LLNP) platform specifically engineered for enhanced DC targeting.. By reducing PEG–lipid content to 0.3% and proportionally increasing the concentrations of structural lipids and mRNA sixfold relative to the Moderna classic formulation, we generated LLNPs with enlarged size and optimized surface properties that favor DC uptake. |